Assessment & Research

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

Corbani et al. (2012) · Journal of intellectual disability research : JIDR 2012
★ The Verdict

New MECP2 mutations can produce mild Rett, and the same kids can still learn to talk with AAC.

✓ Read this if BCBAs working with girls who have global delay or known MECP2 changes in clinic or home settings.
✗ Skip if Practitioners looking only for behavior plans with no interest in genetic background.

01Research in Context

01

What this study did

Doctors in Lebanon looked at the MECP2 gene in girls who had delays and low skills.

They wanted to find new gene changes linked to Rett syndrome.

02

What they found

The team found two new MECP2 mutations that had never been seen before.

One girl had a very mild form of Rett syndrome, showing the gene can act in different ways.

03

How this fits with other research

Suter et al. (2014) later showed that MECP2 mutations can also show up in people who do NOT have classic Rett features. Together, the two papers widen the picture: the same gene can cause full Rett, mild Rett, or just global delay with OCD or ADHD traits.

Three single-case studies—McGonigle et al. (2014), Howard et al. (2023), and de Jonge et al. (2025)—take these same Rett patients and prove they can learn real-life skills. They used voice-output switches, AAC apps, and parent coaching via telehealth to teach requesting and page-linking. The gene work gives the label; the behavior work gives the hope.

So the 2012 gene paper does not clash with later studies—it simply sets the stage for the intervention papers that follow.

04

Why it matters

If you work with girls who have MECP2 changes, remember the syndrome can look mild. Do not wait for the full hand-wringing picture before starting AAC or FCT. The later studies show these kids can learn to ask for toys, food, or breaks when you use switches or tablets. Ask parents about genetic reports, then move fast to teach requesting—telehealth coaching works.

Free CEUs

Want CEUs on This Topic?

The ABA Clubhouse has 60+ free CEUs — live every Wednesday. Ethics, supervision & clinical topics.

Join Free →
→ Action — try this Monday

Start FCT with a single voice-output switch to teach one clear request—pick the child’s top reinforcer and use differential reinforcement.

02At a glance

Intervention
not applicable
Design
case series
Sample size
45
Population
developmental delay, intellectual disability
Finding
not reported

03Original abstract

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

Journal of intellectual disability research : JIDR, 2012 · doi:10.1111/j.1365-2788.2011.01479.x